Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 4253530
End position: 4253553
Length: 24

DNA sequence
>NC_016048, from 4253530 to 4253553 (24 bp); Oscillibacter valericigenes Sjm18-20 GAGGAAGTGGAAGGGGAAGAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4252609-4253631	Sequence	OBV_45170 - hypothetical protein (Protein is coded in complementary strand; from 4253631 to 4252609)