Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 3805239
End position: 3805262
Length: 24

DNA sequence
>NC_016048, from 3805239 to 3805262 (24 bp); Oscillibacter valericigenes Sjm18-20 CGCCACCGCTACCGCCAGCGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3804595-3805413	Sequence	OBV_40440 - ABC transporter permease protein (Protein is coded in complementary strand; from 3805413 to 3804595)