Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2829862
End position: 2829885
Length: 24

DNA sequence
>NC_016048, from 2829862 to 2829885 (24 bp); Oscillibacter valericigenes Sjm18-20 CACTCCCAGTCCCAGTCCCATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2829377-2829901	Sequence	OBV_29860 - hypothetical protein (Protein is coded in complementary strand; from 2829901 to 2829377)