Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2791291
End position: 2791314
Length: 24

DNA sequence
>NC_016048, from 2791291 to 2791314 (24 bp); Oscillibacter valericigenes Sjm18-20 CATCAGCGTCAGCGTCAGCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2790890-2791762	Sequence	OBV_29570 - putative ribonuclease (Protein is coded in complementary strand; from 2791762 to 2790890)