Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2408962
End position: 2408985
Length: 24

DNA sequence
>NC_016048, from 2408962 to 2408985 (24 bp); Oscillibacter valericigenes Sjm18-20 GCCATGGCCATGGCCACGGCAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2407897-2409375	Sequence	OBV_25660 pepD Xaa-His dipeptidase (Protein is coded in complementary strand; from 2409375 to 2407897)