Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 2379462
End position: 2379485
Length: 24

DNA sequence
>NC_016048, from 2379462 to 2379485 (24 bp); Oscillibacter valericigenes Sjm18-20 TTCTTCTGCTTCTTCGTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2377605-2379494	Sequence	OBV_25210 - putative terminase large subunit (Protein is coded in complementary strand; from 2379494 to 2377605)
ORF. 2379454-2379954	Sequence	OBV_25220 - putative terminase small subunit (Protein is coded in complementary strand; from 2379954 to 2379454)