Sequence retrieval

Genome: Oscillibacter valericigenes Sjm18-20
Start position: 1238824
End position: 1238847
Length: 24

DNA sequence
>NC_016048, from 1238824 to 1238847 (24 bp); Oscillibacter valericigenes Sjm18-20 CCAGTGCAAGTGCAAGTGCAAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1237980-1238858	Sequence	OBV_12910 modA putative molybdate ABC transporter molybdate-binding protein (Protein is coded in complementary strand; from 1238858 to 1237980)