Sequence retrieval

Genome: Bacillus subtilis subsp. spizizenii TU-B-10
Start position: 2002516
End position: 2002578
Length: 63

DNA sequence
>NC_016047, from 2002516 to 2002578 (63 bp); Bacillus subtilis subsp. spizizenii TU-B-10 TAATACTTTTTATCATGGTCATAATACTTTTTGTCGTAATCATAATGTTTTTTATCATGATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2002426-2002689	Sequence	GYO_2126 - hypothetical protein (Protein is coded in complementary strand; from 2002689 to 2002426)