Sequence retrieval

Genome: Bacillus subtilis subsp. spizizenii TU-B-10
Start position: 2740606
End position: 2740638
Length: 33

DNA sequence
>NC_016047, from 2740606 to 2740638 (33 bp); Bacillus subtilis subsp. spizizenii TU-B-10 AGTTCTCGGAAAGGTCTCCGAAACTTCTCGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2740278-2740751	Sequence	GYO_2972 - transcription elongation factor GreA (Protein is coded in complementary strand; from 2740751 to 2740278)