Sequence retrieval

Genome: Bacillus subtilis subsp. spizizenii TU-B-10
Start position: 2230489
End position: 2230515
Length: 27

DNA sequence
>NC_016047, from 2230489 to 2230515 (27 bp); Bacillus subtilis subsp. spizizenii TU-B-10 CTCGCTTTTCTCGCTTTTCCCGCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2229986-2230906	Sequence	GYO_2361 - glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily protein (Protein is coded in complementary strand; from 2230906 to 2229986)