Sequence retrieval

Genome: Bacillus subtilis subsp. spizizenii TU-B-10
Start position: 1795745
End position: 1795771
Length: 27

DNA sequence
>NC_016047, from 1795745 to 1795771 (27 bp); Bacillus subtilis subsp. spizizenii TU-B-10 TCAAAATACTCAAAACACTCAAAATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1795717-1796037	Sequence	GYO_1974 fliE flagellar hook-basal body complex protein