Sequence retrieval

Genome: Bacillus subtilis subsp. spizizenii TU-B-10
Start position: 2103891
End position: 2103914
Length: 24

DNA sequence
>NC_016047, from 2103891 to 2103914 (24 bp); Bacillus subtilis subsp. spizizenii TU-B-10 TTCCTTTTCTTTTTCGTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2103555-2104100	Sequence	GYO_2209 - site-specific recombinase (Protein is coded in complementary strand; from 2104100 to 2103555)