Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2600854
End position: 2600898
Length: 45

DNA sequence
>NC_015966, from 2600854 to 2600898 (45 bp); Rhodothermus marinus SG0.5JP17-172 ACGGCCCGTAGTAGAACGGGTCGCAGTAGAACGGATCGTAGTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2599809-2601212	Sequence	Rhom172_2271 - hypothetical protein (Protein is coded in complementary strand; from 2601212 to 2599809)