Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 1773850
End position: 1773885
Length: 36

DNA sequence
>NC_015966, from 1773850 to 1773885 (36 bp); Rhodothermus marinus SG0.5JP17-172 GCCAGCAGCACGGCCAGCAGCACGGCCAGCAGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1772449-1774137	Sequence	Rhom172_1554 - putative sodium symporter protein (Protein is coded in complementary strand; from 1774137 to 1772449)