Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2871244
End position: 2871276
Length: 33

DNA sequence
>NC_015966, from 2871244 to 2871276 (33 bp); Rhodothermus marinus SG0.5JP17-172 TGGCCCCGGCGTGGCCCATGCGTCGTCCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2871117-2871995	Sequence	Rhom172_2508 - succinyl-CoA synthetase subunit alpha (Protein is coded in complementary strand; from 2871995 to 2871117)