Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 330864
End position: 330890
Length: 27

DNA sequence
>NC_015966, from 330864 to 330890 (27 bp); Rhodothermus marinus SG0.5JP17-172 TCGGGCAGGTCGGGCACGTCGGCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 330234-331949	Sequence	Rhom172_0306 - dihydroxy-acid dehydratase (Protein is coded in complementary strand; from 331949 to 330234)