Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 3076782
End position: 3076808
Length: 27

DNA sequence
>NC_015966, from 3076782 to 3076808 (27 bp); Rhodothermus marinus SG0.5JP17-172 TTCGTCGTCTTCGTCCTCTTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3076762-3078279	Sequence	Rhom172_2697 - magnesium protoporphyrin chelatase (Protein is coded in complementary strand; from 3078279 to 3076762)