Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2655896
End position: 2655922
Length: 27

DNA sequence
>NC_015966, from 2655896 to 2655922 (27 bp); Rhodothermus marinus SG0.5JP17-172 CACCAGCAACGCCAGCAACACCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2654217-2655959	Sequence	Rhom172_2326 - hypothetical protein (Protein is coded in complementary strand; from 2655959 to 2654217)