Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 843756
End position: 843779
Length: 24

DNA sequence
>NC_015966, from 843756 to 843779 (24 bp); Rhodothermus marinus SG0.5JP17-172 CAGAAACAGAAACAGGAAGAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 842029-843843	Sequence	Rhom172_0744 - signal peptide peptidase SppA, 67K type (Protein is coded in complementary strand; from 843843 to 842029)