Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 819671
End position: 819694
Length: 24

DNA sequence
>NC_015966, from 819671 to 819694 (24 bp); Rhodothermus marinus SG0.5JP17-172 GCGGCAGCGGCGGCAGCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 818848-821052	Sequence	Rhom172_0725 - glutamine synthetase catalytic subunit (Protein is coded in complementary strand; from 821052 to 818848)