Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 662489
End position: 662512
Length: 24

DNA sequence
>NC_015966, from 662489 to 662512 (24 bp); Rhodothermus marinus SG0.5JP17-172 CTGCCGCTGGCGATGCCGCTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 662454-663533	Sequence	Rhom172_0582 - o-succinylbenzoic acid (OSB) synthetase