Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 638367
End position: 638390
Length: 24

DNA sequence
>NC_015966, from 638367 to 638390 (24 bp); Rhodothermus marinus SG0.5JP17-172 CGCCCGCGCCAGCGCCTGCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 638245-639063	Sequence	Rhom172_0561 - hypothetical protein (Protein is coded in complementary strand; from 639063 to 638245)