Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 55980
End position: 56003
Length: 24

DNA sequence
>NC_015966, from 55980 to 56003 (24 bp); Rhodothermus marinus SG0.5JP17-172 GCGCCAGCGCCCGTGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 55358-56443	Sequence	Rhom172_0056 - molybdate ABC transporter ATPase (Protein is coded in complementary strand; from 56443 to 55358)