Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 506490
End position: 506513
Length: 24

DNA sequence
>NC_015966, from 506490 to 506513 (24 bp); Rhodothermus marinus SG0.5JP17-172 GGCGGCCGCGGCGGTGGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 506052-506717	Sequence	Rhom172_0456 - TonB family protein (Protein is coded in complementary strand; from 506717 to 506052)