Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2553705
End position: 2553728
Length: 24

DNA sequence
>NC_015966, from 2553705 to 2553728 (24 bp); Rhodothermus marinus SG0.5JP17-172 TCAGCGTGAGCGCCAGCGACAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2551802-2554867	Sequence	Rhom172_2236 - acriflavin resistance protein (Protein is coded in complementary strand; from 2554867 to 2551802)