Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2480490
End position: 2480513
Length: 24

DNA sequence
>NC_015966, from 2480490 to 2480513 (24 bp); Rhodothermus marinus SG0.5JP17-172 GCACCAGCCCCAGCAGCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2478440-2480548	Sequence	Rhom172_2179 - surface antigen (D15) (Protein is coded in complementary strand; from 2480548 to 2478440)