Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2445518
End position: 2445541
Length: 24

DNA sequence
>NC_015966, from 2445518 to 2445541 (24 bp); Rhodothermus marinus SG0.5JP17-172 AGCGCCTGCGCCCGCGCCAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2444696-2447110	Sequence	Rhom172_2152 - MutS2 protein (Protein is coded in complementary strand; from 2447110 to 2444696)