Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2401286
End position: 2401309
Length: 24

DNA sequence
>NC_015966, from 2401286 to 2401309 (24 bp); Rhodothermus marinus SG0.5JP17-172 CGCTGCCGCTGCAGCTGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2401103-2401912	Sequence	Rhom172_2117 - flagellar biosynthetic protein FliP