Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2111931
End position: 2111954
Length: 24

DNA sequence
>NC_015966, from 2111931 to 2111954 (24 bp); Rhodothermus marinus SG0.5JP17-172 CCTCGTCTTCGTCCTCCTCTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2111918-2112754	Sequence	Rhom172_1846 - periplasmic solute-binding protein-like protein (Protein is coded in complementary strand; from 2112754 to 2111918)