Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2093437
End position: 2093460
Length: 24

DNA sequence
>NC_015966, from 2093437 to 2093460 (24 bp); Rhodothermus marinus SG0.5JP17-172 CAGCGCCGGCGCCAGCGGCAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2092748-2093569	Sequence	Rhom172_1828 - Indole-3-glycerol-phosphate synthase (Protein is coded in complementary strand; from 2093569 to 2092748)