Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 2055460
End position: 2055483
Length: 24

DNA sequence
>NC_015966, from 2055460 to 2055483 (24 bp); Rhodothermus marinus SG0.5JP17-172 CCGCGCCGCCGCGTCGCCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
2055343-2055799	Sequence	Rhom172_R0038 - (Protein is coded in complementary strand; from 2055799 to 2055343)