Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 1935716
End position: 1935739
Length: 24

DNA sequence
>NC_015966, from 1935716 to 1935739 (24 bp); Rhodothermus marinus SG0.5JP17-172 CCAGCCCGAGCCCCAGCCCCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1934842-1937214	Sequence	Rhom172_1685 - capsular exopolysaccharide family (Protein is coded in complementary strand; from 1937214 to 1934842)