Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 1556385
End position: 1556408
Length: 24

DNA sequence
>NC_015966, from 1556385 to 1556408 (24 bp); Rhodothermus marinus SG0.5JP17-172 CGCAAACGCAAACGCAAACGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1555651-1558425	Sequence	Rhom172_1352 - translation initiation factor IF-2