Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 1462844
End position: 1462867
Length: 24

DNA sequence
>NC_015966, from 1462844 to 1462867 (24 bp); Rhodothermus marinus SG0.5JP17-172 GCCAGCGGCAGCCCCAGCGACAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1462571-1463023	Sequence	Rhom172_1274 - hypothetical protein (Protein is coded in complementary strand; from 1463023 to 1462571)