Sequence retrieval

Genome: Rhodothermus marinus SG0.5JP17-172
Start position: 1065431
End position: 1065454
Length: 24

DNA sequence
>NC_015966, from 1065431 to 1065454 (24 bp); Rhodothermus marinus SG0.5JP17-172 GCAGCAGCACCACCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1065145-1065498	Sequence	Rhom172_0937 - preprotein translocase subunit SecG (Protein is coded in complementary strand; from 1065498 to 1065145)