Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 766460
End position: 766519
Length: 60

DNA sequence
>NC_015942, from 766460 to 766519 (60 bp); Acidithiobacillus ferrivorans SS3 ACGGACAAAAAAGTATCATCCCGGAAAAAATAGTTTCATCCTGAACAATAAAGTATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 766356-766493	Sequence	Acife_0745 - hypothetical protein
ORF... 766476-766604	Sequence	Acife_0746 - hypothetical protein (Protein is coded in complementary strand; from 766604 to 766476)