Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 3138870
End position: 3138893
Length: 24

DNA sequence
>NC_015942, from 3138870 to 3138893 (24 bp); Acidithiobacillus ferrivorans SS3 GCTGCCGCAGCCGCTGGCGCTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3138406-3139638	Sequence	Acife_3210 - hypothetical protein (Protein is coded in complementary strand; from 3139638 to 3138406)