Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 3034587
End position: 3034610
Length: 24

DNA sequence
>NC_015942, from 3034587 to 3034610 (24 bp); Acidithiobacillus ferrivorans SS3 GCGCCAGCACCAGCACCAGCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3033413-3036112	Sequence	Acife_3099 - DNA polymerase I (Protein is coded in complementary strand; from 3036112 to 3033413)