Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 2195846
End position: 2195881
Length: 36

DNA sequence
>NC_015942, from 2195846 to 2195881 (36 bp); Acidithiobacillus ferrivorans SS3 GTGGTGCCGGTGGTGCCGGTGGTGCCGGTGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2195746-2196225	Sequence	Acife_2216 - hypothetical protein (Protein is coded in complementary strand; from 2196225 to 2195746)