Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 1962870
End position: 1962896
Length: 27

DNA sequence
>NC_015942, from 1962870 to 1962896 (27 bp); Acidithiobacillus ferrivorans SS3 CCCGGCATCCCCTGCATCCCCGTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1962441-1962896	Sequence	Acife_1986 - phospholipid/glycerol acyltransferase (Protein is coded in complementary strand; from 1962896 to 1962441)
ORF... 1962893-1964386	Sequence	Acife_1987 - hypothetical protein (Protein is coded in complementary strand; from 1964386 to 1962893)