Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 191075
End position: 191107
Length: 33

DNA sequence
>NC_015942, from 191075 to 191107 (33 bp); Acidithiobacillus ferrivorans SS3 ACCTGGTCCCGACTTAGTCCCGACTTGATCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 190862-192442	Sequence	Acife_0178 - putative transcriptional regulator (Protein is coded in complementary strand; from 192442 to 190862)