Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 1898003
End position: 1898029
Length: 27

DNA sequence
>NC_015942, from 1898003 to 1898029 (27 bp); Acidithiobacillus ferrivorans SS3 TTGTTTTGCTTGTTTTGCTTGTTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1897971-1898351	Sequence	Acife_1913 - hypothetical protein (Protein is coded in complementary strand; from 1898351 to 1897971)