Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 189635
End position: 189658
Length: 24

DNA sequence
>NC_015942, from 189635 to 189658 (24 bp); Acidithiobacillus ferrivorans SS3 CCGCCGCCGCCACCACCGCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 188926-189942	Sequence	Acife_0175 - anthranilate phosphoribosyltransferase (Protein is coded in complementary strand; from 189942 to 188926)