Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 1889234
End position: 1889278
Length: 45

DNA sequence
>NC_015942, from 1889234 to 1889278 (45 bp); Acidithiobacillus ferrivorans SS3 CCCACTGCCTGTAAGCCTACCGGCTGTAAGCCTACTGGCTGTAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1888049-1889380	Sequence	Acife_1902 - hypothetical protein (Protein is coded in complementary strand; from 1889380 to 1888049)