Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 1882411
End position: 1882470
Length: 60

DNA sequence
>NC_015942, from 1882411 to 1882470 (60 bp); Acidithiobacillus ferrivorans SS3 CCCGCAGGGGGGCTCCCGGTAGGGGTGCTCCCAGCAGGGGTGCTCCCAGCAGGGGTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1882102-1883817	Sequence	Acife_1898 - P-type conjugative transfer protein TrbL (Protein is coded in complementary strand; from 1883817 to 1882102)