Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 1875558
End position: 1875581
Length: 24

DNA sequence
>NC_015942, from 1875558 to 1875581 (24 bp); Acidithiobacillus ferrivorans SS3 CTGTATCTGTATCGGTATCTGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1874999-1876528	Sequence	Acife_1890 - ParB domain-containing protein nuclease (Protein is coded in complementary strand; from 1876528 to 1874999)