Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 1634995
End position: 1635018
Length: 24

DNA sequence
>NC_015942, from 1634995 to 1635018 (24 bp); Acidithiobacillus ferrivorans SS3 AGGCGGAGGCTGAGGCAGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1634979-1635347	Sequence	Acife_1637 - iron-sulfur cluster assembly accessory protein (Protein is coded in complementary strand; from 1635347 to 1634979)