Sequence retrieval

Genome: Acidithiobacillus ferrivorans SS3
Start position: 1552113
End position: 1552136
Length: 24

DNA sequence
>NC_015942, from 1552113 to 1552136 (24 bp); Acidithiobacillus ferrivorans SS3 ATGACCACGACCACGACCATGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1551444-1552703	Sequence	Acife_1553 - type II secretion system F domain-containing protein (Protein is coded in complementary strand; from 1552703 to 1551444)