Sequence retrieval

Genome: Rickettsia heilongjiangensis 054
Start position: 864628
End position: 864651
Length: 24

DNA sequence
>NC_015866, from 864628 to 864651 (24 bp); Rickettsia heilongjiangensis 054 AGGCGGTGGCGGAGGTGGAGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 863972-865681	Sequence	Rh054_05015 - putative WASP, N-WASP, MENA protein (Protein is coded in complementary strand; from 865681 to 863972)