Sequence retrieval

Genome: Mycobacterium canettii CIPT 140010059
Start position: 982573
End position: 982617
Length: 45

DNA sequence
>NC_015848, from 982573 to 982617 (45 bp); Mycobacterium canettii CIPT 140010059 GCATTGCCGATGTTGCCGTTGCCGAGGTTGGCGTTGCCGATATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 982024-983310	Sequence	MCAN_08791 PPE13 ppe family protein (Protein is coded in complementary strand; from 983310 to 982024)